CBrugiaQ_581


Sequence

>CBrugiaQ_581 (7 EST) Length=681 TGTCATCCGAAATAAGTGATAAAGATTCTTAGTTTGAGCGCTAACATGATCCTGTCATCAACGTTCTACGTCGTACTGGT TATCGTCAATACTGCTATTCATACCGAAGGAACATCTGTATCCCGGTCATTTTCTTCATTCATCATCCACTTTAATAATA CCATTTGTAAAGTTCAGGATGGTGTTCTCTCGATCAATAATAAAGTGATTGGTAATTTAACGGAGCAGCAGAAAAAGGAA TTGGAAATGTTCACTAATCGAACGGATCAGTGGTCCAGTCAGTTGCATCAACGCATCCAAGAGTTTTTTGGAAGAGTTTT TGGATCGGTGAAGAGCATGTGGGATAATGCATTGAATTTTCGTTCTCAGCTCCCGCAAGCATCCATGTCAGACGACATTA CCACGGGGGAATAAACTAGAAAATCAGGGAGATGATGATCCTTCGATTTTTAGTGTCTTGGACCCACCATCATTTTGTAA AGTTAATTGAATGCTATAAATGGCGTATTGCAATTGATGTGACCAACACTTTTTATTTAATATTTTTATTTGTGAAATTT TAATTTAATTTTCTTTATTTAAAATATATTTCCTNGCCGNNTGATGTTATAACTAAACCATATCNACCATGGGGTTTAAT TGTTATTATGCCAAATTTTATTCCATACTTCCCAANGGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_581: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217652808474R47587SWAMCA110SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5771591378371W69071SWAMCA999SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6826261549454AA056827SWMFCA1026SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7524121668396AA114500MBAFCE6B08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10482702064917AA406925MBAFCZ6H08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12617392392935AA585523SW3D9CA080SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12617512392947AA585535SW3D9CA113SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 17:12:44 on Thu 23 Nov 117.