CBrugiaQ_584


Sequence

>CBrugiaQ_584 (2 EST) Length=677 GCCGCGTTACACTACCAATTCCTCTCTCTCTTCATTACGCGTTAACGATGTCAAAAGCAGCAAAAAAGAAGTCAAGTAAG AAAAAGTCTGGCTCGGAAGCAGCTCAGTTTGATCAAAAGACAATCCAGGAATTTAAAGAAGCATTCGGTATTATGGACCA AAATAAGGATGGAATAATTGACAAACAAGATCTAAAGGATCTCTATGCAATGATGGGACAAATTGCATCAGATGCTCAAA TTGATGCAATGATCAAGGNAAGCTCCTGGACCCATTAATTTCACTGTTTTTTTAACATTATTTGGAGAAAAATTAACAGG GACGGATCCAGAAGCAACGATAATTGGTGCATTCCAGATGTTTGATAAGAGAGACTGCGGCAAAATATCAGAAGACGAGC TATTAAAAATTTTGCAAAACAAAAGAGGGGAACCATTTGACGATGATGAAATCAAGGCTATGTATAAGGGCAAGCCGCCA GTTGAAAATGGTCAAGTTGATTACAAAGCATTTGCTCATTTGATAACAACGGGCGCTGCTGAAGAACTTGCTAAAGCATG ATAACAGTAACAGTTCCATCCTCCATCCGCCCAAAATAATGTTTTGCCGGGAACTTCCTCCTTGTTATAATCCCCTTATT CCCTAAATTTAGAAATAAAATTGAAAAAGAATTTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_584: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826091549437AA056777SWAMCA1549SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10429912055222AA401621SWAMCA1700SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 4:49:38 on Sat 25 Nov 117.