CBrugiaQ_585


Sequence

>CBrugiaQ_585 (2 EST) Length=687 TTTGATGANACCAATTTTATTGTCAATTTGCAAAACANCAAAGCAATCAAATAGATGTTTCTTGANCNTAAGTTCTTCCG GAAAACAATCCAAACAACCTACTGCACCACAACAGATTGGTAGTTTGTGCAACACGTCCAGTGCAGATGTACAGTTGGCA CCGATACTGGTCAGTAACGTGATCCAGAGCGAGAGCGAGTTTTTGACCTCGTTTTGGAAGGAGACCGTGAATTTGATGAA TGCACTGGAGATGTAGCACGTCGAACAAATGATGTACGAGTGTGAGAACGAGAGCGCGAAGAACGTGAACGACTTCTNGA TGCTGAGCGTGTAGGACTGTATTTCGGTGATGAGCGCGTTTTGCGTGGTGTATGTGAGCGAGAACGCGAACGATTCGGAC TGTTAATATTCGCTTCCTTTACTCTAATATACGTTACTTCACCCNTCATGCGATTCGAATTCTTGTATCATCCAGTCTTC CCGAAGGGCATATTTCCATGTATTTCGTAACTTGTCTATCTCGACAACACCAGCGCCATCTCGAAAAACATCGTGCACAG CATATTCTCGTGCCGAATTCGGCACGAGTTTTTTTTTCCTTTTTGAACCCTTTTTTTTGCTTATCAAATACGAGCTAATC ACTGTAAATCACCAATGCAGTAAATTTTGCGGAAAGGAATATATATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CBrugiaQ_585: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11536482246862AA508985MBAFCW1H09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13870802663020AA681015SW3D9CA549SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 5:16:13 on Sat 18 Nov 117.