CBrugiaQ_589


Sequence

>CBrugiaQ_589 (4 EST) Length=560 CCAAAACCATTATTTCCACCACACAGATGCAGGTATCCATGATGGGCGGAAATGAGCGATTTTCTTGCGCCTTGCTCTCC AACTGCAATGGAATATTCGGACCACCAATCATGCCACCAGAAGCAATCGTTGCTCGATCCGCATGGCTTAATAAACTCAT CGCTTTGCTCGAATTTATGTTGTGTTGCAGTCGCGTCTCAGTATCAGAAAGCGGTGTTAATACGATTGGTTTCTGAGCAG CAGATATAAAAAATTGGCATTTGTCAAGACCGTACGGTGGATGTACATCTTTAGAAAGAAGAGCGAGCAGATCTTCACGG CCATAACGATTTTTTACGAAAACTGGATCCGCTATAGGACAATCGACTGTGGGATTTTCAACAGCAAATAGTGGTTCCGT ACGATTACCGCTGCTATTTCCACCTCCAGCCGATACCGGCATAGAAACGGGACGCATCCATGATGGATTGAAATTTAACT GATTTGAATCAGCAGCAACAACAGTAGTAGACATTTCAAAGTGTTGGCTTTGGTATCAAAAGCAATGGCAGAAAACCTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_589: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4425231164671N41073SWMFCA317SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6363991486164AA022382SWMFCA513SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6364521486217AA022435SWMFCA684SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6838281550587AA057934SWMFCA955SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 6:26:23 on Thu 23 Nov 117.