CBrugiaQ_59


Sequence

>CBrugiaQ_59 (2 EST) Length=829 GGACTTTCTGGAAAATCACAGCTTTTATTTGCATTCGTTTTCACATCGCGTTATTTAGATCTCTTCCATTTCATTTCATC ATATAATACTATTATGAAGATCTTTTTCCTTGTATCTTCATATGGAACAGTCTATCTGATGTTTTTCAAGTTCAGAGCGA CTTATGACCGGAGTCACGATACATTTCGGATTGAATTCTTGGTTATTCCTGCAGCAATACTTGCTTTTCTCATCAACCAT CAGTTTTCATTTATGGAGATTGCCTGGTCATTCTCCATATATTTGGAAGCAGTTGCCATTATGCCTCAGTTATTCATGCT TTCACGTACTGGGAGTGCGGAAACAATTACTGCTCATTATTTATTTGCATTGGGGACATAGCGCGCTTTATATATCTTGA AACTGGATATATCGTTATTACACTGAAGAAATTTTCCGATCCTATTGCAACTGTTGCTGGTGTTTGTACAAACTGTACTT TACGTTCAAATGTTTCTATCTGTATGTTACACGAGTGATTCGAAGATACGAAAAATCTGGGAACTTCCCGCTTAGTCTTT TTGGTTATCAAGGATCGCTTCCTCCCTGCTTGTGTTTAAATAAGGAAACTATCTTTATTTGCTTAAAATAATTTTAAATC GGTGTTTAAATCAATTGGTCGAATGCAGGGTTGGTAATTTAAAATTGGGAAATTGCTTAATTAATCCACTTATTTCCGGG GAAAATTGGGTTTTAATTCCTTCCTTTAAAAAAGTGAATCGAATGGAAAGTTTGTGGGCAGGGAACGAATAACTTTTGGA AATCNAAATTTTGGGCCTGGAAGGCACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_59: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6837981550557AA057917SWMFCA917SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11919252307167AA545876SWMFCA2425SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 9:1:7 on Tue 21 Nov 117.