CBrugiaQ_590


Sequence

>CBrugiaQ_590 (11 EST) Length=559 TGAGATAAAAAAAAATGGTGAACCCAAAAGGTATTCGTCGTGGTACACGTTATATGTTTGCTAGAGAATTTCGGAAACAT GGGATTGAACCGTTGTCGACATTTTATCGGACTTACAAACGTGGTGACATCGTAGACATTAAAGGAAACGGTGCCTTTCA GAAGGGTATGCCTTTCAAGGCATATCATGGACGAACTGGACGTGTTTTTAATGTAACCAAACATGCTGTAGGAGTTTTGG TCAACAAACGCGTCAGAAACCGCATTCTACAAAAACGTATTAATGTTCGCATCGAGCATGTGAGACCGTCGAAGTGTCGT CAAGATTTTCTGAACCGAGTTAAGGAAAATGAGGAAAAGAAGAGGATTGCGCGGGAAACTGGTCAAATGGTACCAATCAG AAGAATGCCAAAAGAGCCGAGGAAAGCCCATTTGGTCAAAACACGTTCCAATAAGCCTCAGTTGCTCGTTCCAGTAAAAT TCGAAATTATTGCTTGAAAAAAATCATATATCTTTTCGTTGTTTGTTATAATAGCACTGGAATAAACATTTTGTGTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_590: (11 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676401537120AA051953SWMFCA841SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8809911870975AA241709MBL2SJ8C3T3Brugia malayi second stage larvae JHU96SL-BmL2
8984861893091AA257420MBAFCZ2A3T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9164061917026AA275541MB4SLY1A02T3Brugia malayi L4 JHU93SL-BmL4
9164781917098AA275463MB4SLY1G09T3Brugia malayi L4 JHU93SL-BmL4
10481562064803AA406824MBAFCZ4H11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10777502130933AA433456SW3ICA2344SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10988752168045AA454376MBAFCX0G11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162242199365AA471601MBAFCX4D07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11887662289630AA542718MB4SLY2E03T3Brugia malayi L4 JHU93SL-BmL4
13668832605421AA661377MBAFCW3C08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:8:45 on Mon 20 Nov 117.