CBrugiaQ_607


Sequence

>CBrugiaQ_607 (2 EST) Length=566 TTCATTTCAATGACACAAATCATTTGGTTCAGACTTTCTGCTTTGGATCGCTTCGGCTGAGAATGGAAGTATCTCTCTAC TAAACCTCGATATCGATGATAATATATGGGATGACTGTAGCAATGGGTACTTCTCAACATAGTTTCAATATCCTTGATAA CAGCAATTTGGAATCGATTCTGGGTTCAGATATGGATGCTCATAACAGCAAGACTAGGAAATTCTGCTGACAATTTGCAG GATAGCATTTCATCTGATTTTTCGCACCTCGATTTTACTGATTTGGAGAAAACTAAACATAGAAGCAATGAGGATTCCTA AAATCCGAAACCGTGCCAATCCACAACAGGAAATTATCAGTTGACGAGAATTACCCGAGAACAGATGGCAAGAATATGAA ACCAGTAGCCATTCCGAATAAACACTGGAGAAATCCGAAAATTAAAAACTGATCTCCTTTACCTGGAAAAAAACCTGGAC TTATTTGTTCCTGCCAAATCCTTCCCCTTTNCCGATGAAGAAAATTACAAGTTTTCCCCCTATCGGATTTTCTTATGAAA ACCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_607: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826321549460AA056833SWMFCA566SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6838471550606AA057953SWMFCA976SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:36:14 on Wed 22 Nov 117.