CBrugiaQ_609


Sequence

>CBrugiaQ_609 (2 EST) Length=743 TTNCCANTCANCNACAAGAGCACCCNAACCCNTCTGCTCNTCTCTAGCTGACTTGCTGTAGCANTTGCTCGTTCCCACGT CAACTTGCGCATCATCNAGATCACCCNAGTAAACGTGATCGTGCNTTTNCCCAATGTNATAATTTTTTGNNTAGCNTGNT CAAGTGCTTCTTGTAATTCANTAATNNTAATACCTTGTTGACGACGTACTTCTTCAAGTTCAGTAGTNTGAAGCANACCA TCTTGCTCCAAACGTGATTGCCATTGCTGTATTTCACCATTTGCTTTACTTAATTGTCTTGCAACTTCATTCTTTGANTC AATTTCTTCCTCTAAANTATTATGTGCTTGTTCCGCTTCAANTTGTAAATTTTTCACTTGCGCTCCAAGAACTTGCCGNT TCACGTAATTCTTCCATCAAGTTGCTGAGACGAATATCCCTCCAATTTGTTGTGTTAATTGTCCGGTAAATCGTTGTAAT GNTGAAATTTGCTCTTCTGCATCTTCTAATTGTCTTATCATATCACTATTCTCATTTCCAAGACGATTACGTACTGAACT ATAATCATGCAANTGACGTGATTGCTCATCTGCACGTGCTTGTAAATCATTTAATTGTAANTCAAANTGTTTTACTAATT TTTCATTGCTTACTTTAGCAGCACTTTCACCATCTAATTGTGCAGCTAAATCTTCCGTATTACGCACATATTGCATTTTA TCTTTTACCAATTTTNGCNTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_609: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4427401164888N41290SW3ICA1020SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4448171167714N43194SW3ICA913SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 6:20:10 on Fri 24 Nov 117.