CBrugiaQ_610


Sequence

>CBrugiaQ_610 (10 EST) Length=547 CAAGTTTGAGGTGACGTGGACGTACTGGTATAGTAAGGCATTCGCAGTAACTGAAGAGATTATACACGATGGTGCGGATG AGTGTGTTAGCAGATGCGTTAAAAACTATCAACAATGCTGAAAAGCGTGGTAAACGACAAGTTCTAATTCGACCATGCTC GAAGGTAATAGTACGTTTTCTAACTGTAATGATGAAAGCTGGCTATATTGGTGAGTTTGAAATCATTGATGATCATCGAG CAGGGAAAATAGTTGTTAATTTAACGGGTCGCATCAACAAATGTTCCGTAATTAGCCCGCGTTTCGATATTTCCTTGAAA GATTTGGAGAAATGGACATCCAATCTTCTTCCTTCACGGCAGTTTGGACACCTTGTGTTGACAACTTCGGGTGGAATTAT GGATCATGAAGAAGCGCGCAGAAAACATCTTGGTGGAAAAATTCTTGGGTTTTTCTTCTGATTGCTCTTAAAGATGATTT TATGTTTTTGTTTTCCAAATATGTTTTGACATTCCAGAATGGAATAAAAATAAATTTTATTACTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_610: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435294
217661808483R47596AS3ISA008SLBrugia malayi infective L3 JHU93SL-BmL3
5304511300201W23347SWAMCA489SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8001851737568AA161558MBAFCF1A11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8713621855018AA231977SWMFCA1372SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8808781870862AA241544MBL2SJ0F10T3Brugia malayi second stage larvae JHU96SL-BmL2
8810931871077AA241694MBL2SJ9E1T3Brugia malayi second stage larvae JHU96SL-BmL2
10750892113566AA430884RRAMCA1480SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11539732247187AA509310MBAFCX9G08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11918702307112AA545821SWMFCA2314SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 23:39:49 on Sat 18 Nov 117.