CBrugiaQ_615


Sequence

>CBrugiaQ_615 (11 EST) Length=675 AACAGGTAGCACCGGACNATTNGGGACTGTTNGATAAGATGGGGTTCAACCTTCAGCAGGNTTTGGTCGTTCGGAAAATT NCNCCNGAATTTTCTTGGGAACGTTTCTNATGGATTCGTGCCTCCGTCCTTCAACCGGTGAGTTTGGCACCTTTTTTGCG TGCCAATGGAACAGCATAATGTGCTTCGTACCACTGACGAAATGGAACAGCATCAACAGTAATTATTGAATTTTTAACCA GTGTCTTAGTGCGTACTAATTCATTATTGGATGCATTATATACGGTGTCGACGATACGTGTTTTACGGGTGCAACCTTCT GATCCCCACGAAAATGTACCAACATCAAGTCTCAGTGCACGATGCTTGATATTTCCACCACGGCAACGAACAAGATGAAT TCTTTTTGGACCAATTTTTGTATTTGATGCAGGACGCCCGAGCTCGAACTTCCTCTTTTTATGTGGCGGACATCTCTTTC CACCAGTAGCACGTCTCTTATGCCAATTATCACGTGAAATACCCATCACCAATCAACTTGAGGATCTCAAACTTGGGTAA TTAAACCCGGAATTCCAGATATCCATGTGTCCAATAAGTTTCATTTATAAGTATAACTCAATTACCTTTGTTAACTTATC ATCCTGTAAGTTCGGGAATAAAATTTATCAAATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_615: (11 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
309252924253H48201SW3ICA292SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4061771118183H97298SW3ICA467SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8808421870826AA241477MBL2SJ0C5T3Brugia malayi second stage larvae JHU96SL-BmL2
8808921870876AA241558MBL2SJ0H2T3Brugia malayi second stage larvae JHU96SL-BmL2
8810401871024AA241732MBL2SJ8G10T3Brugia malayi second stage larvae JHU96SL-BmL2
9165421917162AA275514MBL2SK1G09T3Brugia malayi second stage larvae JHU96SL-BmL2
9165501917170AA275522MBL2SK1H06T3Brugia malayi second stage larvae JHU96SL-BmL2
11888022289666AA542754MBL2SK3A02T3Brugia malayi second stage larvae JHU96SL-BmL2
11888112289675AA542763MBL2SK3B06T3Brugia malayi second stage larvae JHU96SL-BmL2
12354432369538AA584985SWMFCA2800SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13736312629546AA668047MBAFCX8H11AT3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:10:12 on Thu 23 Nov 117.