CBrugiaQ_617


Sequence

>CBrugiaQ_617 (4 EST) Length=556 CAAGTTTGAGGAAGAAATGAGTGTAGAGCTTTCTTTCAAAGATTTGAAAGCACTTTTGGATGATAATAACATAGATTTAA GTATGCGTCAGCTGGTATCCATCCCAGTAAAAGGTTTGAGTAAAATTCCGCGTGCTACATATCTCGACTTTTCGAACAAT TTAATAACATCGATTCCATCAGATTTCTGCCTATTAACGCATGTTACCAAGTTAGATCTTAGCAACAACCATATCGTCCA TTTGCCAGAAGAATTTGGCAAACTAATCAACCTAGTTCATCTTGACCTTTATAAAAACGAAGTTGAGGAACTCCCTTTAT CTTTCGGTGAACTGGCTTCACTAAAATGGTTAGATCTGAAAGGCAATCCTTTGGAATTAGAACTTTCACAAGCAGCGGGC GAGTGTTTGAATGAAAAAGGTTGCAAAACGGCTGCTTTGAATGTTGTACGACTCATGCGTGATCGGTCCGTCGAACAACA ACGACTTCTTGAAAAACAGAAATCTTCCAAAAGACAATTCGAAGACAGCGATCTAGGCATCATGTGTTAACTGTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_617: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343525973929R95199SW3ICA366SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141111912481AA273107SWMFCA1936SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11887482289612AA542700MB4SLY2C05T3Brugia malayi L4 JHU93SL-BmL4
13813812655501AA675795MBAFCW4H06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 6:50:16 on Tue 21 Nov 117.