CBrugiaQ_621


Sequence

>CBrugiaQ_621 (5 EST) Length=558 GTTTGAGATATTGTTAGATGTCTGCTACATAAGATATCACCGAGCTATGTAAGCAACTGACCAGCAATAATAATCAGTAA TTTGAAAACGAATCGATAATATCATCTATNTNNAGATTTTGATTACTAACGAAAGTGCTGATTCGCTTTGCTACAAATGA CCGTTGCTGAGAAATTTGCTGGTACTTGGACGTTTGCTGACTCGGAAAATTTCGATGCTTACCTGAAACAAATTGGTGTT GGTTTAATAATGCGAGGTATAGCAAAAAATCTGAAACCGACACTGACTTTTTCCATGAATGGTAATAAATGGAAGATTGT TAGCGAATCACGTTTCAAAAAACATGTTTGGGAATTTGAACTGGGTGAAGAATTTGATGAAACAACACCCGATGGACGAC AAGTAAAGAGTAAATTCTTTCTGGAAGGAGACGTATTAGTTCAACTCGAAAATGCCATAAAGGCNANCGATAAGAGTACT AGGTTTGAACGTTACATCGACGAGCAAGGTCNATTANTTATTGTTTGTGACTCCGAAGGTGTTGGTTTGCCAAACCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_621: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7471541660764AA109346MBAFCE0B02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7619861681854AA123543MBAFCE7F04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10429872055218AA401617SWAMCA1680SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11160412199182AA471418MBAFCX2C10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11537832246997AA509120MBAFCX7E06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:19:52 on Mon 20 Nov 117.