CBrugiaQ_629


Sequence

>CBrugiaQ_629 (5 EST) Length=550 TTGAGGACGAAGACTAAAACGAATTTCATCGAAATCGTTCAACTTCTCAAATACTCTTTCATCAATAAATAGCGAAGCTG ATAGCAACAATAAATTTCATTGTACTGAGCAACAAGCGCAAATATCGCTAGCGCCACATTCCGGTAACTCACCATTACCG CCTCTGCTACTCAATCAACAGTTTATCTTTCTCAACGATAATATTGTTGGCATAGTAACACAACGTCAGTGGACAACATC AGCAGCACAGTCATCTTCGATTAATTGTCACAGCAAAAGTAAAAGTGTCATGTCAGCAAAAGTAGAAACAACAGTACGGC AATGGTCGACACCAATCGAAAAGGTTGTCGAAGGTCAACCACCAAAACCTGAAGATCGTCCAACGATAATCCATGGTGAA GCGCAAAATCTGTGATACAGTCTATAACGCCCAACTATAAAAGTTGTTTAGTGAAAGACAAATACAAAAAATGGATTTTG GTTCCAGATTTAAATTTACCAGAAGCTGTTGGCGAATATAAGGTGAAAGAAACNCAGATCATTTTAAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_629: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4452311182258N43730SWMFCA180SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7272481634893AA089414SW3ICA1782SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8249091769738AA185850SW3ICA1953SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8962991889979AA255376SW3ICA2414SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10859912153575AA441697SW3ICA2509SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 14:37:18 on Fri 17 Nov 117.