CBrugiaQ_63


Sequence

>CBrugiaQ_63 (3 EST) Length=856 GAGTAAACGGTTCGGGAGAGGTGNAGNATNAAGCCCGGTATTGGAACCGGATTNAATTAAAGGGTGGTTGTGANACCCAC AAGTCGGGACCANAGNTTCATAGTTCCATGGTTCGGCAGNGGAGTTACTGGNTNTTCACTTCGATCGATTANTAATAAAA ACGGGTCGGCTTTGGCATTTTCAAATAAGCTTTNTTCGCGAGCGATTGCCTTGGCAANTTCTTCAGCCAACAATTTGCTA TCTTNGTTAGACTTTTGATATCGTATTTCGGGTTTCTTTTTTAATGCCCAGTAGTGTGGCAATGATTGAATTTAGAGCTC GCGTAAAAAACTGGTGTCAAAACAGAGAAAAGATGAGTCATAGCTATGAAGAATATTTAATGACAGAAGATGCGGACACA AAGGAACGCCATCCATGAAGAATTCATGCATTTCACGGACCGTTTCTTGGTCATCCGCCTCCGCCAGTGCTTTGACGTCA GTTTTGCTAATGATGTTACAAAAATATATATAATATTGGCCATATTTCGGAAATCGCAACTCATCAGCTAATAGGTGAAT GTTTTCTGTGGTAGGTCGTAAAAATGTTATACATTTGAGGTACTTTATTGGCTCTCTCAAAGCAATAGAATCGATGCGTT CAAACAAATACACTTCTTTCTGCATCATATCGCTTTGTGCATAAACGCATGATACAGCACTGGTCGTGCATTTATCCATC ATCATCACTTTCATGCCAGGACCAGCCAGCCGGATCATTTCCGATATGTACTGTTGAGTNGCCGTGACAACATCCATTGT ACTTCCGTTCCCTGCTATCCTCCGCCCTCCCAAATCTCCTTATTTCTCTATAACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_63: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291637902169H31013SW3ICA280SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7061611592579AA072506SW3ICA1511SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
12618782393074AA585662SW3D9CA415SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 9:2:39 on Tue 21 Nov 117.