CBrugiaQ_632


Sequence

>CBrugiaQ_632 (7 EST) Length=994 TTCTGNACCAACCTTTCATTTACATAAAAGAGAACTTCAACAATCGATACACATGTGTGATGAAGTGTTTTTAAAAAGTA ATTATATTTCTATTTCGGGTTCGTAAGCAATATCCCGCCCAAGCTCAGTAGCAAATTCGTAGTACAGCTGCGAAACATCA AATGCTGGAAAGCGAATTTTCTCGGTCGGCGAAATGTGCACCATATTGCAAACACCGCCAGAACCGGTATCACGATAAGT AGCATGCATTATTCCTCGCCGACCCAGTTTGTATGCTTCTTCATCTGTCATTTTAGGACGGTAAAAATTGTCTAGGATAC CATAAGCACTCAGTGAACCTGAACCTATGCTACACAGTCTTAACTGAATGCGCTGTCCTTCACTGTCAACTTTAAAAATC GCAGGACCACGCTTGTCATAGCCAGCAATCATGGAGCCGACTGATAGTCCATGGTTTCGATAAGAATATAAAACATTCTG GAAATATTTGCTTGCAGCAGCCACAGTAATTTCCGTTTTTTCTCGAAGCTCGTACAGTGTGCAATATTTAGCAACTATAC GTGTCCAAAATTGACAGTCGGCGGCACCACCAGCCATAGTTGCCACCATTCGATCGCCGATGTCCAGTATTTTCATAACA CTCTTGGACGATATGTATTCTCCAGCAGATGCACGCGAATCCACAGCAACTATAATCCCTCCTTTATCTGCTGGCGTTTT TGGCTCATAGATGAATGCAAGTGTTGTAGTTCCTTTCAAAAACTGCAAATTCTTTGCACCCGAATGTTTGCCGAAATGTG ATTCGACAAATTCAGCAGGTGTTCCATATGGAGGCTGCATGAAGTACAAGTCGTCTATGACTGGCTCGTGAAGGTCACGC TGTGGCACGTCATCACCTACGCTGCCGACTAACATGGATATCTGTAGAAAGAGGAACCCAAACTCCTCCAAGTATAATCA AATGAGCTGGGGCCGCAATTCCTGCAGCCCGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_632: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7619891681857AA123546MBAFCE7F07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8983671892972AA257496MBAFCZ0F6T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538442247058AA509181MBAFCX8C02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539152247129AA509252MBAFCX9A12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539402247154AA509277MBAFCX9D08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13667272605265AA661221MB3D6V4C10T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13860732660435AA680487SWAMCA3084SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 8:55:1 on Mon 20 Nov 117.