CBrugiaQ_636


Sequence

>CBrugiaQ_636 (102 EST) Length=547 ACAGACGTTCNCTCCACCATTTAGCTCCACCTTCGGTGGCCGGCTGCTCTAGAAGCGGTTTAATTACCCAAGTTTGAGAA ATGAGAGTATTGATGTAGATGCTTTAACAAGTGCTGCTCGACTTGCTATGGATCGAGCATACTGTCCGTATAGCAAATTT ACTGTTGGTGCTGCTTTATTAACCAAAGATGGTAAAATAATCACAGGAGGAAATGTCGAGAATGCATCTTATGGTGGAAC AATATGTGCGGAACGGAGTGCAGTAACACGTGCGGTAGCTGAAGGTTATCGTGAATTTCAAGCAGTTGCAGTTTGCGCAA CACCAGCTGAGCCTACTGCTCCTTGCGGACTTTGTCGACAATTTCTTATTGAATTTGGTGACATGAAGGTAATAATGATA TCATCAACTTCCAATAAACGAATAGAAATGCAACTTTCACAGCTAATACCACTATCATTTACAACAAAAGATTTGATACA TTAAAATGTAAAATGGTTCTGGAAGAATTGCGCCCAAAAAAAAAAAAAAAAAAGAAGCGATACAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_636: (102 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435259
1435270
1435273
1435321
325130951340R88404TNPIBM4001Brugia malayi infective L4 JHU93SL-BmL4
4061631115068H97257KJ4SLB028T3JHU93SL-BmL4 (JHU)
4061651115070H97259KJ4SLB031T3JHU93SL-BmL4 (JHU)
4157021122645H98424KJ4SLB111T3JHU93SL-BmL4 (JHU)
4157041122647H98426KJ4SLB113T3JHU93SL-BmL4 (JHU)
4448771172259N43376AS4SLC456T3Brugia malayi L4 JHU93SL-BmL4
4448891172271N43388AS4SLC474T3Brugia malayi L4 JHU93SL-BmL4
4448901172272N43389AS4SLC473T3Brugia malayi L4 JHU93SL-BmL4
4449001172282N43399AS4SLC511T3Brugia malayi L4 JHU93SL-BmL4
4449291172311N43428AS4SLC557T3Brugia malayi L4 JHU93SL-BmL4
4449301172312N43429AS4SLC551T3Brugia malayi L4 JHU93SL-BmL4
4449371172319N43436AS4SLC589T3Brugia malayi L4 JHU93SL-BmL4
4449451172327N43444AS4SLC576T3Brugia malayi L4 JHU93SL-BmL4
4449481172330N43447AS4SLC577T3Brugia malayi L4 JHU93SL-BmL4
4449521172334N43451AS4SLC562T3Brugia malayi L4 JHU93SL-BmL4
4449541172336N43453AS4SLC789T3Brugia malayi L4 JHU93SL-BmL4
4449701172352N43469AS4SLC828T3Brugia malayi L4 JHU93SL-BmL4
4449831172365N43482AS4SLC848T3Brugia malayi L4 JHU93SL-BmL4
4449901172372N43489AS4SLC844T3Brugia malayi L4 JHU93SL-BmL4
4449911172373N43490AS4SLC839T3Brugia malayi L4 JHU93SL-BmL4
4450071172389N43506AS4SLC797T3Brugia malayi L4 JHU93SL-BmL4
4576291193266N52100KJ4SLB108T3JHU93SL-BmL4 (JHU)
4576331193270N52104KJ4SLB165T3JHU93SL-BmL4 (JHU)
4576601193297N52131KJ4SLB260T3JHU93SL-BmL4 (JHU)
4958911442882N89552KJ4SLB195T3JHU93SL-BmL4 (JHU)
5594031345224W51522AS4SLC493T3Brugia malayi L4 JHU93SL-BmL4
5594041345225W51611AS4SLC491T3Brugia malayi L4 JHU93SL-BmL4
5594111345232W51618AS4SLC510T3Brugia malayi L4 JHU93SL-BmL4
5594161345237W51524AS4SLC549T3Brugia malayi L4 JHU93SL-BmL4
5594221345243W51530AS4SLC591T3Brugia malayi L4 JHU93SL-BmL4
5594481345269W51556AS4SLC661T3Brugia malayi L4 JHU93SL-BmL4
5594551345276W51563AS4SLC728T3Brugia malayi L4 JHU93SL-BmL4
5594681345289W51576AS4SLC764T3Brugia malayi L4 JHU93SL-BmL4
5594831345304W51591AS4SLC835T3Brugia malayi L4 JHU93SL-BmL4
5594851345306W51593AS4SLC842T3Brugia malayi L4 JHU93SL-BmL4
5594871345308W51595AS4SLC851T3Brugia malayi L4 JHU93SL-BmL4
5594901345311W51598AS4SLC863T3Brugia malayi L4 JHU93SL-BmL4
5595001345321W51608AS4SLC882T3Brugia malayi L4 JHU93SL-BmL4
5595091345330W51628AS4SLC896T3Brugia malayi L4 JHU93SL-BmL4
5595101345331W51629AS4SLC898T3Brugia malayi L4 JHU93SL-BmL4
5595121345333W51631AS4SLC901T3Brugia malayi L4 JHU93SL-BmL4
5595191345340W51539AS4SLC911T3Brugia malayi L4 JHU93SL-BmL4
5595311345352W51505AS4SLC932T3Brugia malayi L4 JHU93SL-BmL4
7062111592629AA072528MB4SLD042T3Brugia malayi L4 JHU93SL-BmL4
7062351592653AA072552MB4SLD023T3Brugia malayi L4 JHU93SL-BmL4
8557781817181AA216477AS4SLC628M13RBrugia malayi L4 JHU93SL-BmL4
8557901817193AA216489AS4SLC701M13RBrugia malayi L4 JHU93SL-BmL4
8678891850654AA228548KJ4SLB371T3JHU93SL-BmL4 (JHU)
8981661892771AA257282MB4SLM1A1T3Brugia malayi L4 JHU93SL-BmL4
8981761892781AA257259MB4SLM1B1T3Brugia malayi L4 JHU93SL-BmL4
8981791892784AA257262MB4SLM1B5T3Brugia malayi L4 JHU93SL-BmL4
8981911892796AA257294MB4SLM1C8T3Brugia malayi L4 JHU93SL-BmL4
8981951892800AA257298MB4SLM1D1T3Brugia malayi L4 JHU93SL-BmL4
8982011892806AA257304MB4SLM1D9T3Brugia malayi L4 JHU93SL-BmL4
8982181892823AA257347MB4SLM1F11T3Brugia malayi L4 JHU93SL-BmL4
8982191892824AA257348MB4SLM1F12T3Brugia malayi L4 JHU93SL-BmL4
8982531892858AA257382MB4SLM2B12T3Brugia malayi L4 JHU93SL-BmL4
8982571892862AA257386MB4SLM2C8T3Brugia malayi L4 JHU93SL-BmL4
8982601892865AA257389MB4SLM2C11T3Brugia malayi L4 JHU93SL-BmL4
8982621892867AA257391MB4SLM2D5T3Brugia malayi L4 JHU93SL-BmL4
8982651892870AA257394MB4SLM2D8T3Brugia malayi L4 JHU93SL-BmL4
8982981892903AA257336MB4SLM2G10T3Brugia malayi L4 JHU93SL-BmL4
8983021892907AA257340MB4SLM2H2T3Brugia malayi L4 JHU93SL-BmL4
8983031892908AA257406MB4SLM2H3T3Brugia malayi L4 JHU93SL-BmL4
8986781893283AA257793MBL2SJ3C7T3Brugia malayi second stage larvae JHU96SL-BmL2
9100991906164AA269102KJ4SLB006T3JHU93SL-BmL4 (JHU)
9101011906166AA269104KJ4SLB010T3JHU93SL-BmL4 (JHU)
9101041906169AA269107KJ4SLB018T3JHU93SL-BmL4 (JHU)
9101051906170AA269108KJ4SLB019T3JHU93SL-BmL4 (JHU)
9101081906173AA269111KJ4SLB034T3JHU93SL-BmL4 (JHU)
9101211906186AA269124KJ4SLB148T3JHU93SL-BmL4 (JHU)
9101321906197AA269135KJ4SLB052T3JHU93SL-BmL4 (JHU)
9101341906199AA269137KJ4SLB062T3JHU93SL-BmL4 (JHU)
9101351906200AA269138KJ4SLB065T3JHU93SL-BmL4 (JHU)
9164351917055AA275420MB4SLY1C12T3Brugia malayi L4 JHU93SL-BmL4
9164621917082AA275447MB4SLY1F04T3Brugia malayi L4 JHU93SL-BmL4
9164671917087AA275452MB4SLY1F09T3Brugia malayi L4 JHU93SL-BmL4
9164681917088AA275453MB4SLY1F10T3Brugia malayi L4 JHU93SL-BmL4
9164741917094AA275459MB4SLY1G04T3Brugia malayi L4 JHU93SL-BmL4
9164801917100AA275465MB4SLY1G11T3Brugia malayi L4 JHU93SL-BmL4
9164831917103AA275468MB4SLY1H02T3Brugia malayi L4 JHU93SL-BmL4
10312162042852AA389866KJ4SLB047T3JHU93SL-BmL4 (JHU)
10312242042860AA389874KJ4SLB293T3JHU93SL-BmL4 (JHU)
10312302042866AA389880KJ4SLB303T3JHU93SL-BmL4 (JHU)
10312372042873AA389887KJ4SLB322T3JHU93SL-BmL4 (JHU)
11887672289631AA542719MB4SLY2E04T3Brugia malayi L4 JHU93SL-BmL4
11887822289646AA542734MB4SLY2F11T3Brugia malayi L4 JHU93SL-BmL4
12618102393006AA585594SW3D9CA275SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12618272393023AA585611SW3D9CA323SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12619032393099AA585687SW3D9CA457SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12652062402577AA588914KJ4SLB362T3JHU93SL-BmL4 (JHU)
12652082402579AA588916KJ4SLB369T3JHU93SL-BmL4 (JHU)
12652092402580AA588917KJ4SLB372T3JHU93SL-BmL4 (JHU)
12652142402585AA588922KJ4SLB402T3JHU93SL-BmL4 (JHU)
12652172402588AA588925KJ4SLB340T3JHU93SL-BmL4 (JHU)
12652192402590AA588927KJ4SLB345T3JHU93SL-BmL4 (JHU)
12652262402597AA588934KJ4SLB446T3JHU93SL-BmL4 (JHU)
12652282402599AA588936KJ4SLE014T3JHU93SL-BmL4 (JHU)


Date: 6:7:8 on Sun 19 Nov 117.