CBrugiaQ_64


Sequence

>CBrugiaQ_64 (2 EST) Length=953 GCAAATTTTTTTATTAATTTATCAANGTTGTATCATTTGCAATTGTTTCCTGGATTACCTATGTATTTTGTCATTTGTCA TTTCCAAAGGTTGTCCGTTNGCATGTTTTTTTGTCGNTAANGGAATTCCAAGGNTAAATGGTAGAACCAAGCACCAAATG TTGCGCCAGCAAATGGAACAAAGATTGGTNTCAAAAACCATTTATAATTTCGATAGNTGAAAACNTCCCAACCATAACCA ACAGTGAATGTTACAAGTTTCGGCCCGAGATTTCTTGCCGGATTAATTTCGCCACCTGCATTTGCCGTAACACATACAGC AATTAAAATAATTGAAAAGATCAGAACTACCGGTTGCACCGCTGGTGGAATTTTATTTCGTGGATCAGTAAACATTATCA CACAGAATGCTAAGAGTGCTGTGCCAACAAACTGATCAAAGATGCAACCAGAAATGCTCAAATAATCTTGTGGCCATGGA ACAAATATTCCAATTGTTGCTCGTGGACCAATAATTTGACGCTCACCGCCGTCAAAATGATTTATTCCATCATAATAGAG GAAAAAAGTGACCAAACTACCAGCAAATGCGCCAGATATTTGAGCAATTGAATACATTATGAATCTAAACACTGATATAT GGCCACAAAGATAAAATGCAAACGATATTGCTGGATTCATATGACCACCTGATAAATGACCAGCTGCATATGCACCAAGG CCAATTGCTAAAGCCCATCCAAGGACTACGCAAATTTTGCAATTAGCACCTTCGAGTAGATTAACTGCATTTGTCGATGT CCCAGCAAACACAAAAAAAGCAGTACTGGTGAATTCCGACAGAATACATCGCATCAAATCATTGCGAATTCGTAATTTAT TTCGTACTATGGTAACATTATCCATTATAATTAGTATTCAAAATTATAGTGGTTTAATTTTGTTTTATTCTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_64: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11162312199372AA471608MBAFCX4E05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12618872393083AA585671SW3D9CA427SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 21:52:46 on Sat 18 Nov 117.