CBrugiaQ_645


Sequence

>CBrugiaQ_645 (14 EST) Length=559 CGCGGTGGCGGCCGCTCTAGAGCCGTTTAATTACGACCCAAGTTTGAGCAGTATAAAGCCATGGGAAAACCGAAGGGTAT ACGCACAGCGCGTAAACTGAAAACGCATAGACAAGCTCAGCGTTGGAATGATAAGGGCTATAAGAAGGCACATTTAGGAA CACGATGGAAGGCGAATCCATTTGGAGCAGCATCGCATGCTAAAGGCATCGTCCTAGAAAAAGTAGGTGTTGAAGCAAAA CAGCCAAATTCAGCTATTCGCAAATGTGTTCGTGTGCAACTAATTAAGAATGGAAAGAAGATCACAGCATTCGTACCAAA TGATGGTTGCTTGAACTTCATTGAAGAAAATGACGAAGTTCTTGTTGCTGGCTTTGGTCGGAAAGGACATGCTGTGGGTG ATATACCTGGTGTACGCTTTAAGATTGTCAAAGTAGCGAATACATCATTGATTGCACTGTTTAAAGGAAAAAAAGAAAGG CCACGTTCATAAATAAAAAATTCTTGGTTGTTTCGTTGTCGATAATTGTTATGTGGTGGCTATTATAAAATTTTCTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_645: (14 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435265
4449501172332N43449AS4SLC569T3Brugia malayi L4 JHU93SL-BmL4
4576341193271N52105KJ4SLB166T3JHU93SL-BmL4 (JHU)
5594731345294W51581AS4SLC774T3Brugia malayi L4 JHU93SL-BmL4
7473031660913AA109273MBAFCE2B05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7566341673259AA118210MBAFCE6E04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7566391673264AA118215MBAFCE6E09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8810011870985AA241719MBL2SJ8D1T3Brugia malayi second stage larvae JHU96SL-BmL2
8810101870994AA241585MBL2SJ8D10T3Brugia malayi second stage larvae JHU96SL-BmL2
8982841892889AA257250MB4SLM2F5T3Brugia malayi L4 JHU93SL-BmL4
8987151893320AA257739MBL2SJ3G4T3Brugia malayi second stage larvae JHU96SL-BmL2
9165281917148AA275500MBL2SK1E09T3Brugia malayi second stage larvae JHU96SL-BmL2
9165291917149AA275501MBL2SK1E10T3Brugia malayi second stage larvae JHU96SL-BmL2
10481792064826AA406847MBAFCZ5G11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:27:52 on Wed 22 Nov 117.