CBrugiaQ_653


Sequence

>CBrugiaQ_653 (10 EST) Length=554 CATCGTAGTNGTNGACGGATCCGATAATATATCCGTCGATATGTCCGNACACCCGAGCGAGAACGAGAGCGACGACGTCG AGAGAGAGTGCGACGACGAGACCGTGAACGGCGGCGGCGAGATAAAGAACGACGACGGGGGCTGCGAGAGCTTAAACGAC GACGGCGACGGGCGTTTGAACGGCGACGACGTCGAATGCTACGGCGTGATCTCGACCTATATGAGCTCCGACGTGATCTA GATCTATACCTTGGTCTGCGCCTTCTGTTCGATAATAGCCTCAGCAAATCAAAACCCAGTACTGATCGTGGTCGTGAACG TGAACGTGAGCCTAGCCGTCGTCGACGCCTTACAGGTAATAATGAAAGGGATGTAGCACTCTGTAAAGTACGTGAACGAC TTCTTCGCCCTCGTGAACGTGATCGCGAACGTCGGTACGGCATTTGTTACTCAGAGTTATCCTTTTAATCCTTCAGTAAA TTCCAACAATGTTCCCTTTTTCCAGTTAGTATTCCATTTTAGAGTGACCAGCAATGAGAGAAAGTGCCGAATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_653: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
296606905410H35906SWAMCA173SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5014661266987N94642RRAMCA1181SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5596531349159W51731SWAMCA628SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6675021531512AA051806SWAMCA1433SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6807291547292AA054885RRAMCA259SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10614452078595AA417424RRAMCA1410SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10614552078605AA417395RRAMCA1420SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10750982113575AA430893RRAMCA1490SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13860792660441AA680493SWAMCA3090SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13860802660442AA680494SWAMCA3091SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 5:56:7 on Sun 19 Nov 117.