CBrugiaQ_660


Sequence

>CBrugiaQ_660 (2 EST) Length=654 CCGATTTATGCTTTGTGCTTAGATTAAGAATGAAGAGGTTCATATCCATAACGTATTATTGTATGGTTCGTAAAGATTAG TAGAATATGATATTTCATAAGACGTTTTCCGGGACTTCTACGAGCCGTGGGCATTGATTCGACATGACGAATGCATTGGT TTATCTGGAACACTGATGGCACTTTCAGTTCTTGATTGTAATTTGGCACTAGATCGACCACAACTAGAAAATCAACCCGT AACCGTTGAGCTGGCGGCTTATGTACGTTTACCAAACCTATCGAATAACCCTAATAGTGAAAAGGAATCTGATATGGTTG ATGAAAAGTCGCTGGAACTCGCCCTTGATCAAAAAAATTATTTGGAACAACGAAATAATTATTTGGAAATTCGGTATCAT CACTGTAGATCTAAAGTGGCTGAATTGAAGACGAAAATAGAAGAAATCAATCTATCTGGTCCCAATAATATCAGTTTAGC TAGTGCTGCAACGGAAGATACGCCGAAGATGTTTAATGATCATATTGCTGAAGTGGAAATATTAAAANAGGAGAAAGAAG AACTAGCTCAGTTAGCATCTGAAAAAGAAGATTCCATACGANTTNGCACGGCAACAACTAGCAGATACGANAAAGTGANT GTCGATTTGTATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_660: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4384961158245N37103SW3ICA616SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11918892307131AA545840SWMFCA2360SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 15:24:26 on Thu 23 Nov 117.