CBrugiaQ_661


Sequence

>CBrugiaQ_661 (7 EST) Length=773 CAAGTTTGAGATTTAAAGGAAAGAGAGACTTTAAGGTAGTGGATGAATGCAGGTAATATAAAAGTTACACTTGTACAGCG ACAATTGCGAGAAGACTGGAATAATCGAGAATACGCGCAGGTAGTTTCTGATAACATTCGACATATCGCGGATTTTCTCT GTAACTTTGAACTGTCTTGTCGGAGCAGAATCGCAGCACTTAGTGATAAGGTGTCACTACTAGAACGAAAAGTGGAATTT CTTGAAGCCAGACTATCGCGAGGTGAAACATTGAATTGAACAAAAATGGCAACAGGTATGATAAGAACTGCTACAGCAAC TACACGTGAAGTTATTCCCATTGTATCAGCCAATAAAGCACAGAGCCGGTCGAATGTGCTTGCTTTATATAAAGAAATGC AACGCTATGCTCCGAAACTCTACAAACAGTTCCATTTTGATGATATGCCGCTGTCCGTTTTTCGAGCAGCTTTAAAAAAG CAATATATTAATAACGCACATTTGACCGATTTTCGTGTTATTGATCGGAAGATTGCTGAATGCCGTCAAGTGATGTTGGC CTGTCAGAAACATTGGTATAACTCTTACCATCTGCGAAATAACTTGTTCCGTGAAAATGTTGAAGCGAAACCTAAAGATT TCTTGTCGACTTTTCTTAGGAGCAAAAATTAATTCTGCTGTTAATCAGTGATAGATCGTGCTCATATAATCACACTATTG TTTGTATGGTCACAATTTTATGCTTATTTATGAATAGTANAATATTTAATTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_661: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4811811237151N74842SW3ICA1407SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7484801662351AA110604SW3ICA1835SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7522711668255AA114424MBAFCE3C05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10483422064989AA406971MBAFCZ7G05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162582199399AA471635MBAFCX4G11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11938472314999AA547798MB3D6V1A05T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13668982605436AA661392MBAFCW3E03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 9:34:27 on Thu 23 Nov 117.