CBrugiaQ_67


Sequence

>CBrugiaQ_67 (9 EST) Length=822 ATTTCGTGCCTTNCGTTCTNGGGCGACGGCACGAGGGAATATAAAAAGAATCAAGGAAAAGAAAAAATGCAAAGAGAAAG AAAAATAGATGTTACCCCGAGTAATTATTCAGTGCTGGATACTGAGTTTGGAAGTATGCGGGAACGTTTCGAGACCGAAA TGAGGCATGTTGAGGAAGAAATGAAGCGTCTAAGGCGAGAATTTGAAGGATATACGCCATCACAGCCAGGATCACAAGCG GACAATCGCTCCACCACGTATCATCGTGAAGAATCCAGACGTTACGAGTCATCCTCAACACAGGGCAGCGGCCCTCCTCC ACCAAGCAGTACATTCCGTAGTGAGGGAGGTTTTGGACGACCGGATATGATGTCCATTCGACCAACATACGATCCTTATC TGGAAAATCTTAAATCACCGCTTATCAAAGATGAAAGTGATGGAAAAACACTCAGACTTAGATTCGATGTTGCACAGTAC AAACCAGAAGAAGTTAACAGTAAAAACAGTTGATAACAGACTTTTGGTTCATGCTAAGCATGAAGAAAAAACACCGCCAA CGTGCCGTATTCAGAGAAATATTAATCCGGANTTTATGCCTTCCCCGTGGGAACAAATNCCCAAACTGGATTTACCAGTA CGCCAAGTTTCGGATGGCGTTTTTAACCGGTGAAGCACCCGCTACCCCACCTGGCTATTCNCACTGAATTTGGGTTATCC GCTTCTATCATATAATGTTTGGATGATGCCATGATGAATATCCNCCTCNCAAACCCNTTTTTCCCCCCCCTAAANTCTTT TTACACCATCCNTNTGATCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CBrugiaQ_67: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291586902118H30962SW3ICA209SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6676251537105AA051938SWMFCA710SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7473291660939AA109443MBAFCE2D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8981631892768AA257240SWMFCA1546SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8981651892770AA257242SWMFCA1548SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9139691911893AA272966SW3ICA2461SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11588202252997AA514180SWMFCA2300SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12213092345206AA570913SWMFCA2738SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13669282605466AA661422MBAFCW3G10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:36:22 on Wed 22 Nov 117.