CBrugiaQ_681


Sequence

>CBrugiaQ_681 (4 EST) Length=554 ATTTAAAAAATTTTCATTTCAAAACATTACCAAAACCTGGGTCGGGGGAGTAATAGTTGGAAGCAGTCCAATTCGGGACA TTGGGAGGAAGTTCCGGAGCTTTTCCAAGCCACTATATCCGGATGGGTGCCAACAAACTGGGTTCGGAATTTTGGAGCAA ATTATTCCATGGAGCAGATAAGGAAGACCGTAAATCAAAAACTTCGGAGAAATTGGGTGCCATGTCATGTCGTTTATAAA ACTTGAATGTTCGCTTGAATAAAGAGTCAGAAGGTGAGCGATCACGATAACCGTTACCATCATTCACACCTATTAAATAT TTGTCAGTCTGATCTGTTGACCGCTTGTCGGATACGCTCGTCATGTTTCGTTTTATAGTAGCGTAACAGTTCACTTTTGC GCAAATCCAATTCGTCCTGAAGTCCCTGAAGTGGTTCATAGACAGTCGCCACACCATATGCTCCAATTGCTAGACCAACA ACAGCAAAAACAATNTTCGCAGCTGCTTGTTTTGGTGTTAATCGAAGTTGCCAACTTACCATGTCACGAAATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_681: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6000521416475W91808TEMFCA0075SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6722771537224AA052046SWMFCA770SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6826381549466AA056839SWMFCA612SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13247842539427AA627040MBAFCW2G12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:18:17 on Sun 19 Nov 117.