CBrugiaQ_685


Sequence

>CBrugiaQ_685 (6 EST) Length=625 GCACAAGGAAATTTAATAGGAGACAGAAACANTGGAAGCCAGAAGGAAGACATTTGACAAATCATTATTAGAGTGTTCAA ATCTCATTGTCTAGGACAGAAGTTCCCAAAAAAATAAAAAAGAAATTCAAGAAGCAGGCACCAACGGCAAACAATACAAC ATGCAACACGGCCACCAGCATTACCGGTTTTAAGACTTTCGTCCTTCTTGTCACCAACTCCTTTCCCGAGATCGTCTTGA TCAGCATGCACAACAATTGAACGGCCAATTATTGAATTGGGACCGAGTAACTGTACATGCTTATCAGAAATATCAATGTG AGCAGTGCCATCAGCTCCAGCCACAATATTTCCAAGATCACCAACATGTCTCATTTCATCGGTTGGACCGCCATGTGTTT TATTGTAAGGGATTGAAATGTGGACCAGCAGAAATACATCCGTTTGTAGTATCACCGTATTGATGTACATGAAAACCATG CAAACCGGGAGTTAAACCTTTGATTTCACCACTAATAGTTGTTGGCGATCCTTCTTTCTCCTGTTTAAATCGAATAATCC CATTAACATTATCGCCACGTAACACAGCTATTGCATTCGCACTCATGATAAAATTTCAAATCTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_685: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435264
4156311122575H98353SW3ICA504SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8428351799500AA203757SW3ICA2008SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8944711887896AA253547SWMFCA1442SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8982671892872AA257396MB4SLM2D10T3Brugia malayi L4 JHU93SL-BmL4
8986731893278AA257788MBL2SJ3B12T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 14:22:56 on Fri 17 Nov 117.