CBrugiaQ_697


Sequence

>CBrugiaQ_697 (3 EST) Length=559 CCAGTCTTTTCCGTTCCTCTAGATCGGTCAATAGTGTTGCCAATTGCGTCTGGAAAGCTGCAAATTCAGGAGCAATCGAG GTTGCACTTTTCTCAATTGTCTGCACTCGTTTTGCCACCAATTCTAATCGTTTTTGAGCTTCTCCTATCCACTCCTTATC AGTGATATATTTTGATGAAAATGACTTGGATACATCCTCTTTTGGTAATGTCTTTGCAAATGTGTTAGCATCAACTTTTG GAATGCTTGGTGGCAGCACTTGTCCGAAATTCATCTCCGCATATTTTTTCATTAAACATTGTATTGCCTCATTGATTATA TTTTCCTCAAAAAGGGCTTTTTCCTCCAGATCTTTTCTCGATTGGTAAATAACAAATCGCAGCTCAGTCCGTACAACGTT TTCTTCTGGTTCAGTCCTTTGGATACGAATCATTTGCCGCGGTAACACTCTTCCTTTTGAATCCGCCGCATCTTCAGTGC CTATGGTTCTCGATTGCTCAGCGTCATGTCCTGCACATGTCCTCATTGATCTGTATAGAAGGCACAACCGTCTAATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_697: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6806891547252AA054918SWAMCA1507SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6806901547253AA054919SWAMCA1508SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10987552167925AA454256RRAMCA337SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 6:52:59 on Mon 20 Nov 117.