CBrugiaQ_70


Sequence

>CBrugiaQ_70 (8 EST) Length=796 ANTTNTTCCGGTTTTTGGGGNTCCGGGTTCAGGAANANGTTTCGGGNTTGTCCCAGNTCTTCGGGGTTCNNGTCATCCTT CGTCATCAAAAANATTTTNGNTTCATTCCCNAATNTTCCGGTTTTCTTNGGGTCNGGATCCTTAATTTTTTTTNGGAGGN AAGAAAGTCCCAATNGGNTTCCAAGTTCACCAGAATGCATACCGGGCCCCCATTTGGAATTGGTAAGGTATCGATAAGCT TGATATCAGAATTCAACAATCAATGTGTAAAGATGCGTGAAGANGTCATCCTTGCATCGGGATGTCTTTCTTGATCATGT GATTCCTAACCCTTGTAATGGAATATGACATGAACTTTCTTTGTTCCAGGTCCACAAATGTCCGGACCGAACATAATATG ATAAGGAGTTTCGCCATGGAAATCTTCTAGGTTTACATCTGATGCCATCAGCTTAATGTAGCCACCGCCACAGTCGATGT CTTGTTCGTGCTTAACGCTAAATTGGACAACCAGTGATTTACCCTTGTTTGAAAAACCCTTCTCAAATTTTGCACCAATC GAATAAAACTTTGCATCCTGTGCAGTCTTAAGACCTCTGTCTTTCACAGCGTCACCGTAAAATTTTCCATGCGATATTTC CCATTTGCCGAAATCATCCTTATGTTTTGATTTTATCCATCTTTTTTCCCAGTCATCATCCGAAAACTCTTCCTTGAAAT ATATTTTAGCACTGACTGCCGAAAAGCAAACAAGTCCTAACAGCAAATACAGCTGCATTCTNCTCAAACTTGGGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_70: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320237945438R86411SWAMCA370SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4445701167371N43069SW3ICA1116SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4446941167591N43209SW3ICA1131SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447671167664N43282SW3ICA751SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5251821293888W18214SWAMCA661SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5594931345314W51601AS4SLC872T3Brugia malayi L4 JHU93SL-BmL4
7062001592618AA072493SW3ICA1639SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
12618682393064AA585652SW3D9CA399SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 7:20:25 on Mon 20 Nov 117.