CBrugiaQ_711


Sequence

>CBrugiaQ_711 (5 EST) Length=573 TTATAAAAGTTCACAAGTTTTTATTACAGTGTACTACTTCATACAGCTTAAAAGAAATGCTAAAAGGACAAAATGGAGCA AAAGCATAGGGTAAGGAGGACAAACTGGAGTAAAAATATGGAGTAAAGATGTATAACACAAGAATATGCATTACTATTAT GCAATCACAAACCAAATTTGACAGTACATGTATTTGGAGCAAGGAAATAACACAATGTGAACATACGAATAGAGCTCTTG TAAATATGCTCATTTGAATATAATCCATATTTCATTTCATAATCACATATTAAGCACCACCACGTAGTGCAAGTACCAAG TGAAGGACTGATCCACCAGCAACCTTGTAATCTTGTGCTGTTTTTTCATCATTCATTTGCTTTCCGGCGAAAATCAATCG CTGCTGTGGTGGAGGTATGCCCTCCTTATCTTCTACCTTTTCCTTGATTCTTTCCACCTTATCATTAGGTTCAATATCGA GCTCGATTTCCTTCCCAGTCAATGTTTTCACCTTGATTAACATCCCTTCAAACCAATTACCTGACCAACCCTTGGGAAAA CCCTCGATAATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_711: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8001621737545AA161522MBAFCE9G02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002101737593AA161583MBAFCF1D12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10483022064949AA406957MBAFCZ7C08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161102199251AA471487MBAFCX3A10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13946052675710AA688428SWAMCA3093SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 23:50:13 on Sat 18 Nov 117.