CBrugiaQ_716


Sequence

>CBrugiaQ_716 (2 EST) Length=654 GCTCAAAAATGCCGAACGGATACGTGAAAAAAATTAAAGCACTATTAATGAGAGGTTTTTCCTGTTGCCAAATCCATATA ATTGCAGCATCTACCGCATTAATCTCTTNTTCGACGTNTAAATCGCATCGTGCGATAATATTTGCGAAAATAATTGGTGG TATATGGCCAAAAAATTTATGTGGCACAATATCAGGAAATTTGGCTGCTGCAATTTTTTCAATTTTTTGGACGGAACATT TAAACCAACTATAAATTGAGCGTTCGCTTCCTACGATAATTAGTGGCTTGGAGAAGTGAATCTGTTTTTCTGTGATGCCA TTTTGACAAGAATATTTTCGGAGTTGTTTGAGTAAGCCAAGCATAAGTAATGATCGTGATAAATCGATTAGATCAGCTAA TGCATAAAATGATAATGTGATATTTTTTTGATTCTCATTCTGGATGTATCCTACTAATGCTCTTACAGAGTTTTTATCAT ATGCTGATAAATTGATATATTTTGGTAAGCGACCAGTTTTCAATAGCTCCTCGTGCCGAATTTTCAACGAACAAATTGTA AATTGTTGCAGTTTAACGCGATACTTTTCTTCTGATGCTATCAATTTTATCTTTTTGTCAGTACTTTCATTACGTTNTGC GCTGGTGCCGAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_716: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8003261737709AA161679MBAFCG0F07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8865211878433AA247104SW3ICA2214SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 20:28:57 on Tue 21 Nov 117.