CBrugiaQ_72


Sequence

>CBrugiaQ_72 (12 EST) Length=803 GAATCATGCATGAGGCGAAAATCATCGCATTAGTTGCTGCAGCTTGCAGTGCTATGGCAATTTTGTCATGCGTGGTGGTG ATACCATCACTCTACAACGCTATCAATGAGGTACATGATGCGGTAATAGATGGTGTGCAAGTTTTTCGCATCGAGACCGA TTCAGCATGGACTGAACTGATGGACGTGCAAATTAGCGTGACACCACCTAGTAAAGCACGTGAAAACCCCTTCAAAAGCA TTTTCCGTAAGAAAAGACAGGACTTTTCCGGTTTGCCGGATTATTGCCATTGTGAACCGATCAAGATTAGTTGTCCTCCT GGACCAGCAGGTCCAGTTGGTGAACCAGGAAAGGATGGACCACCTGGACTACCTGGTCCTCCTGGAGAAGATAACACAGT AACATACCCACCAATGGAATGTCCTCCTGCTGATACCACTTGTATTAAATGTGAAGCAGGCCCAGCTGGACCACCAGGAA TTGAATGGTGAGCCCAGGANCCGGCAGGACCCGATGGTTCNCCAGGATTGCCAGGACCAGCAGGAAACGAAGGTAAACTG GACAACCAGGGCCAATCGGTGATGCAGCAAACCAGGATCAGTGGGACGCCTGGTGAANCAGGACNCCTGGAAAAANCGAN ANAAAGAAAAGGTGCNCCAGGACTCNAGGACACCCGGACNNCAGGACCCCTGGCCTCNNGTTTGGATGCAAAAAGGACAA AGGACACCGGTCTGCAGGACACCGGCCCCAGGAAAAAAGATTTCCGTGAAAAGGGAACTGGATTCTGTGAACCGCNTCCC GAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_72: (12 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291552902084H30928SW3ICA149SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447281167625N43243SW3ICA679SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4809631236200N74801RRAMCA1072SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7092381613912AA074008SW3ICA1662SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8679781850743AA228637RRAMCA418SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
9076491902754AA266666SW3ICA2348SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10860212153605AA441727SW3ICA2548SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
12617752392971AA585559SW3D9CA151SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12617782392974AA585562SW3D9CA156SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12617862392982AA585570SW3D9CA174SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12618812393077AA585665SW3D9CA420SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13870762663016AA681011SW3D9CA543SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 2:39:11 on Fri 24 Nov 117.