CBrugiaQ_720


Sequence

>CBrugiaQ_720 (33 EST) Length=531 AAACCTTTCATAGAATTTCCAATANTTAATAAAAGTAGCAACAAGCATCAATTTGGCTGCTAAAAGGAGTTAAAATAGAA AGGTAGAATTGAAAGTTTGCATCACAGCTTGTTTTGCTTGCTTTATAAGCATTTACGAGCATTGCCAACTTTCTTGAGGC GCACAATACGAATATTCCAACTTGCCACTGTTCTTTCTTTCGATAACGCATGAATGCAATTTATCATCACAGAAGCAACC TTTGTCTGTCCACGACTGATTCTCGTCCAATCTGCACCAAGCTTGCGGTTCACGCTGGTCGTAGCACGCTTCGTGAGAAG TGCATTCTTTCTTTTTGCCATCAGTTTCAACAAATTCCCCCTTGGTGACATACTCATCTCCTCCTTCACTACCATCTCCT CCCTCATCAGCACCTGAGGATTCGTCGTCGAATTCGTCATCTGATTGTGACATACATGGCAGTGTCACAGTAAGAATAAT TAAGCCAAATGCTATTAGCAATTTGTTCATTTTTTCCTTCTCAAACGATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_720: (33 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217601808423R47536SW3ICA094SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
217659808481R47594AS3ISA010SLBrugia malayi infective L3 JHU93SL-BmL3
217673808495R47608AS3ISA021SLBrugia malayi infective L3 JHU93SL-BmL3
217708808530R47643AS3ISB034SLBrugia malayi infective L3 JHU93SL-BmL3
217714808536R47649AS3ISB060SLBrugia malayi infective L3 JHU93SL-BmL3
273949878855H14035AS3ISB371SLBrugia malayi infective L3 JHU93SL-BmL3
273952878858H14038AS3ISB377SLBrugia malayi infective L3 JHU93SL-BmL3
276412881978H16474AS3ISB271SLBrugia malayi infective L3 JHU93SL-BmL3
276424881990H16486AS3ISB277SLBrugia malayi infective L3 JHU93SL-BmL3
281260890017H21322AS3ISB252SLBrugia malayi infective L3 JHU93SL-BmL3
291534902066H30910SW3ICA122SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
291592902124H30968SW3ICA217SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
291609902141H30985SW3ICA236SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
291611902143H30987SW3ICA239SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
343567973971R95241SW3ICA405SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
3795431054509H77258SW3ICA471SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
3951011088238H92660SW3ICA519SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4123821122562H98340SW3ICA566SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447231167620N43238SW3ICA607SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447691167666N43284SW3ICA753SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447981167695N43313SW3ICA860SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4451731182200N43672SW3ICA1151SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4451741182201N43673SW3ICA1152SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4809501235919N74788SW3ICA1398SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7484791662350AA110603SW3ICA1833SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7484931662364AA110568SW3ICA1854SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8249121769741AA185853SW3ICA1956SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8640411845489AA224705SW3ICA2074SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8640641845512AA224728SW3ICA2177SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8962921889972AA255369SW3ICA2404SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141411912511AA273137SW3ICA2562SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9245841926186AA283492SW3ICA2613SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10860162153600AA441722SW3ICA2543SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 2:28:49 on Thu 23 Nov 117.