CBrugiaQ_726


Sequence

>CBrugiaQ_726 (3 EST) Length=842 GGCACGAGCAGANTAANACGTGACACNATGGCGGATNNCTGGGCGCGAAGATTACATNATCAATAGCTTCGTGATGAAAC CATATCAAAAGCCGGAATCATTTACGGAAAGCTATGCAAGTGGGGACTGTTGCACATGCTCACGAGGACCACCTGGTCCG ATGGGACCACCAGGTCGTGATGGCGCACCTGGAATAGACGGTGAAATTGGCCAACTTGGACCACCTGGACCACCTGCACC TTTTGACGCTGAACTTCAAAGCCAATTTCCACCGCAATGCCCGTGCGATTCACCACCTGGTGAGCCTGGTCCTAAGGGAC CACCTGGACCTGATGGTCCACCAGGACCACCGGGTCAGGATGGCGAAGATGGTAGACCGGGAGATCAAGGACCAAGAGGT CCACCAGGACAACCAGGTCAACCAGGACAGCCTGGAAGAAGTGGACCACCCGGGGAACCAGGAATGTATAGAACAGAAGT TGGACCGCCAGGACGACCAGGTGCTCCAGGACGTCCTGGACCACCGGGACCTATGGGACCACCAGGTACAAACGGTGACN ATGGTCCACCTGGCGCAGCAGGTCCACCTGGTCCTCCTGGGACAATCGGGGACAGCCAGGTCCAAGCGGNACGACCGGGG ACCTTGTTGGGACCACCTTGGAAAAACCTGGCGCACCTGGAAGTTGTGACCATTGTCCACCAGCTCGTCTTGCTCCTGGC TACTAAATTAGATGCGATAATCTATGCAAAGCAGAGAAGGAAGCAAGGAATTGTCATATTAAATCGAAATTGCACTAAAA TTTTTATTGAAAAGTTAAAAATAAAAACATCATTTCATTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CBrugiaQ_726: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12618342393030AA585618SW3D9CA333SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12618902393086AA585674SW3D9CA430SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13870662663006AA681001SW3D9CA522SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 14:18:48 on Sat 18 Nov 117.