CBrugiaQ_729


Sequence

>CBrugiaQ_729 (7 EST) Length=528 ATTTAAAGAAAAAAGTTAGTACTGCCATTAGCGCCAAGTTGTAACGATGGCAGAAAGATTAGTTATAGCACTTGGAATGG CGGCTAGTGCATTTATCATGGGTTTATCAGTGATTGCTGTGATCTTTCTCTTTAGTAATATCAATGATTTGTACAGTGAT GTTATCATTGAAATGACTGACTTTAAGGAAATAGCAGATGATACATGGAGTAAAATTCTATCTGTTCGATCAAATGAACT TCATAATGAAAACAAATATGAGCGCAATTTCGAGAGTCTTGTTTTGCGAGCTAAACGACAGTTCCCAGCACATTGTCAAT GTAGCGCATCGTCTGATCGATGTCCAAAAGGTCCTCCTGGTCCTCAAGGTGATCCAGGATTGAAAGGTCTTGATGGAGCA AATGGTGATGATGGACGTCCAGGTGTTAATGGTGTTGCACTTTTGGCTACTTTCCATATTCCTGGTGGTTGTTATCAATT GTCCCAGCCAGGACCACCCAGGACCACCTGGTTGAACCCGGTCCTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_729: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3951031088240H92662SW3ICA521SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4446951167592N43210SW3ICA1132SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4451811182208N43680SW3ICA1161SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7155641619235AA080326SW3ICA1690SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7484571662328AA110581SW3ICA1803SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7621081681976AA123681SW3ICA1910SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9245871926189AA283495SW3ICA2616SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 22:20:58 on Sat 18 Nov 117.