CBrugiaQ_73


Sequence

>CBrugiaQ_73 (10 EST) Length=802 GGCGGGGAAAATTATTTTCAAACAGGNAAAATTAAACCAAAATTCGGAACAAATCNGNGGGGAANGGATTTTAACCCAAG CAAACCNGGGCCCAAATACCCNAAAAGAAATTTTTTTTCNGGANGTTTCCGGAATCACTTNTAACACCACGTTATTNACA GCTTTNNGATCGGTTTTCTNGGATCAGACACAGTATAATTCGGTTGTCCCCCNGGGNGAATATATNGGCATCGCCTTTTT NGGTGCTTTTTTAAAATTGAATCTCCGGAAGTACGCATCATCAATGTGTTCTGGGACTTTCAATCCTGATATATCAAGTT TTGTCTTCGTTGCAATCACGAAAGCCTGGGCTATACGTCGTAGCGGAGTAGAATTTAATTTCATCGGCCCTGTCACAAGC AAGAGGCCCGATTTTTCCAGCTGCTTCAGAAAGATAACACGCTTTCCCTTATGTCGCCCAGCGAGTATTATTAGAATGGT GCCGGGGGTGATTGATCGCCGTAATGCTGTTTTTTTGGGGGAACGTTTTGTTCGTCGGGTGGTTCTACATTCTTTTAAAT ATTTCGGCTCCTTCTTGATGAGTACTTTTCGCTCTTTGCCATTCTTATCGCCCCCAATCGGCTTCACCACAAACTTCACT TTGCGTCTCATTTTCTTCTCGACAGTAGGGTATGTTTTCTTGGCATACGCACCACGTTTTGCGTACATCCGTGCAGCAGA AAATCGCATAACTCCCGGTGCTACTTCATAATTATGTCTCATACGTGGTACACGCTTTTTTGCCAGCATTTCTCAAACTT GT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_73: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281225889982H21287AS3ISB260SLBrugia malayi infective L3 JHU93SL-BmL3
4811781237148N74839SW3ICA1373SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6364271486192AA022410SWMFCA574SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8985821893187AA257710MBAFCZ3B4T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480632064710AA406744MBAFCZ3B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10989242168094AA454425MBAFCX1D11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11163312199472AA471708MBAFCX5F08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12617412392937AA585525SW3D9CA082SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12774462429588AA598395SWMFCA2965SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13247242539367AA626980MBAFCW2B05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:50:29 on Thu 23 Nov 117.