CBrugiaQ_730


Sequence

>CBrugiaQ_730 (2 EST) Length=409 GGAAGATGAAGTGGAAGTGAATAATGTGGTAAAGATTGTTGACACTGTCAAACCCCACTGTGCCAGTAATGTTCATGTTA ATTTATATGTCTCCAAGGTTGTGGTTCATCCGCTTGTGTTACTGTCTGTGGTTGATCATTTCAATCGCGTGAGTAAAACT CAACAATATCCAAACGTGTGGTTGGCGTATTGTTACGAAGCATGAAACCGAATACGACGCTAGATATTGCTAATAGCTTT GCTGTTCCGTCTGATGAGGATGAACGAGACTAGAAAACTTGGTTCCTCCACATGGATTATTTACAGAGCATGTATGGTAT GTTCCACAAAGTTGCTGCACGCGAAAAAATCGTTGGGATGGTACCNNACTGGTCCCAAACTCTNTTANAATGACATTGTG ATCNNCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_730: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7272101634855AA089376SW3ICA1580SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
13668802605418AA661374MBAFCW3C05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:49:18 on Sat 25 Nov 117.