CBrugiaQ_732


Sequence

>CBrugiaQ_732 (7 EST) Length=546 AATTCATAATATTTAATCTTATGGAAACAATAACAAATACAGAGCGGAAAAAACATAATAATTCTTAAGCAACCAATACA CAGGCACCACCTACTGCCTTTATTTTCTGTTCTGCCGAATGTGAGGAAAAATTTTGCTTTGACTATAACAGGCTGCTTCG GCAGAAGGCCTTTGCCAAGAACTTTGAAATAACCAGCTCGGACAACATCGATTACCGGTGCCTTATCTTTCCTATCCGCA TAAGTTTTTCGCACCTTCTCCGATATCAGTGACCACAGCTTATCAACGTTCACTGTTGGGCAGTATAGTCGGTTACGTCT CAGATGGTAATTTCGCATACCAACCTTTCCAAAATAGCCTGGATGATATTTGTCAAAATTGATACGATGATGATGCTGTC CACCAGCATTACCTCTACCACCTGGATGTTTACGATGTTTTCCGACACGTCCATGTCCGTGCGATACGTGACCTCTTAGC TTCCTTGTCTTTTTCTTTGATGTAGCCATCCAAATCCTCAAACTCTCGTNCCGAATTCGGCACGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_732: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5072341271718W00304RRAMCA1108SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6837801550539AA057899SWMFCA895SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7620061681874AA123563MBAFCE7H07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620701681938AA123536MBAFCE9B07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8984561893061AA257585MBAFCZ1F6T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11160492199190AA471426MBAFCX2D06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12774682429610AA598358SWMFCA3001SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 17:22:23 on Fri 24 Nov 117.