CBrugiaQ_736


Sequence

>CBrugiaQ_736 (4 EST) Length=538 TCAGCATGATCATCCAAGTTTAATAAATGCAGCCACGACAGCAATGGTGTTCACTTCATCTGGAGACGGGTCATTCTTGA TATGCACTAAATGCAATTCGCCAGGATAATGCAATGAAGCAATGGTATGTTCACTTCCAGTATCATTTTGTTGAGACCAG TGAAAGTGAAACTGTGACAGTTGGTAGGTACCATTAAGACCGCCACCAGAGATATACGGTCGCTTCTCACCCCATCTTTC AAAACCGGAACCAACCACAGTATGTCCATTATTTGCCAGGTGAATATGACCGGTGAGATCGTAGTTCAGAAATTGTAAAG GATCTAAAGGTGCAATTTCTATTTCAAATGCTTTAATGTCTACAGGTGACTGACGCTTCCCAGTTTGACATACGCCTCGC CACGTGCTCGGTCCATCTTCTGCATCATAACCAAATTTATGTGCAGCAACATAAAATACAGTAATAGTTGTTAAAAACAG CGCGTTGTGGTGCATCGTTTTGAGATGAGCGAATCTTTCTCAAATTGNNNNNNNNNNG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_736: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8249151769744AA185856SW3ICA1959SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10751002113577AA430895RRAMCA1492SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10751132113590AA430768RRAMCA1508SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10989212168091AA454422MBAFCX1D08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:35:9 on Sat 18 Nov 117.