CBrugiaQ_738


Sequence

>CBrugiaQ_738 (13 EST) Length=519 GGGNGAAGAGAAATCTTTATCNGTGTAGAAAGATCTCCCATTCTCTCTTTTTCAAATGCAACAAATGAATACATAAATAA TAAAACTGATTACCAAATCACCAGTCAGTAACATCTAATTCATCAACACTCCAGTCCTCAAAAGAACCATCGGGAAGATA TCTTCTCACGATAAGAGGTATCTTTTGGTGCTTGAGTTCTTTGCGAGCTATCTCCAACGGATCAGTTTCTCCTTCTAATT CTACCATAACTGGCGCACCCATTGCGATTTGCAACGCTCTCGTGCCAAGGATCCGTGCTCGTTCATATTTTGTCATGAAT GGAGTTGTGACGCGCTCCGTAGATGCTGTTTTCTCCGATCCCTCAACGACTTGTATCCTTTCAGTATCATCTTCGGCCGG TTCCAAATCTAAATCATCCATCTGCTCTTCATCGCCAAAATCATCGGCCTCCATTTCACCTTCGTAGTCTTCGTCTTCCG CCATTTTTGACTCACCTCAAACTTGGGTAATTAAGACTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_738: (13 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435258
354113992887H52891SW3ICA435SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4157131122656H98435KJ4SLB130T3JHU93SL-BmL4 (JHU)
4449411172323N43440AS4SLC580T3Brugia malayi L4 JHU93SL-BmL4
5594891345310W51597AS4SLC861T3Brugia malayi L4 JHU93SL-BmL4
5595341345355W51508AS4SLC938T3Brugia malayi L4 JHU93SL-BmL4
5595351345356W51509AS4SLC940T3Brugia malayi L4 JHU93SL-BmL4
7472471660857AA109387MBAFCE1D03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8810041870988AA241579MBL2SJ8D4T3Brugia malayi second stage larvae JHU96SL-BmL2
8810651871049AA241450MBL2SJ9B6T3Brugia malayi second stage larvae JHU96SL-BmL2
8986801893285AA257795MBL2SJ3C9T3Brugia malayi second stage larvae JHU96SL-BmL2
12617282392924AA585512SW3D9CA059SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12652012402572AA588909KJ4SLB351T3JHU93SL-BmL4 (JHU)


Date: 15:3:56 on Wed 22 Nov 117.