CBrugiaQ_739


Sequence

>CBrugiaQ_739 (2 EST) Length=538 GGAACTGTTCAANGTTAAACTTTTCTAAATGATTCGGATCCTGCAGGGTCACGGATATCCTTTCTTTGAAATGGTTCATC GGTCAGAAGATCTCTCAAGATGTCCAGGTTTCAAGTTTAATTCTTCGATAGCCTCAAGAGAAAATAACATTTCCCTGTTT GACAGATGGTCACAATATGACTTGTGGGTGTGAAGACACGAAAGGTAACAGGACATCGAAAATTACCATCACTGTCTTTG TCGAATTTTAGATGAATCAATTCTTTCGCTGTCATTTTTTTGCCAGTTACTGGATTAACACCATACTTTTTTAGATAGGG AATAATTTGTATCAAGTCAAAAATAATTCCATCTCGTGAACAAACAGGATCCTCAAACGGTAGTAATGATAGAGAACAAT GCGTAATAGGCAAACGCTTGAACAGTGCACGTTGCATTCGCTTACCAGTATCATCCTTGTGACCGCCATAAGTTTCTTTC CATTCGGTAGTTGTCAAATACAGCTTATCTTTCTGATGTTGCTTCTTCCCCATGTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_739: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5221041289176W15136SWAMCA482SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7496611663665AA111775SW3ICA1861SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 11:19:9 on Sun 19 Nov 117.