CBrugiaQ_747


Sequence

>CBrugiaQ_747 (4 EST) Length=525 CCAAGTTTGAGGTCGTGGTGCTAATGCATCCTTGCAGTATTATCCTCTTCATCGCCGTAGCTGTATTCGTAGTTCAAGCT TGCAACCCAACAGCAGGACCACCAGGACGACCTGGACGCAATGGACCTAGAGGAGAACCAGGACCTGAGGGAGATCAAGG AGAACCTGGAGATGAAGGTCCGCAGGGATTACCTGGGCATATTGGTCCGCCAGGAGAGGAAGGTGATAGANGACCGCAAG GAGAAGTTGGTGACCAAGGACCGCTAGGTCTGAAAAGAATGAATAATAACGGATAAAGCAAAATATGGAATTTGTTAGTG ATAACAAAAAAAATCATCCTCACGTATATCTTTTCTCTCATTTTATGCGTTTTTCTTTGCGTCACCATATGGTAACTATG CCTTTCCTACTATATCGCGAAATTCTTAAGTCAGAAATCACAATCGGTGCCTTAATGGAATTTATTTATGGAATTTGAAA TTGAGATATCATGGAACAGATGCTTTTTAACTTTATCACTGTCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_747: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8001581737541AA161709MBAFCE9F06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8985651893170AA257693MBAFCZ2H10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480462064693AA406727MBAFCZ2H10T3ABrugia malayi adult female cDNA (SAW96MLW-BmAF)
11161142199255AA471491MBAFCX3B03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 6:6:54 on Wed 22 Nov 117.