CBrugiaQ_759


Sequence

>CBrugiaQ_759 (3 EST) Length=960 TGAATATGGAAAAGAAAGCGACCTTGCTGCAGTCGGAGAAAGAGGAAATGTCAGTTGCAATGGATCAAGCAGAGCGAACC CGTAAACAATCGGAACGTGATGCGAATGAAGCACATGTCCAGTGTAATGAGTTATCTGCTCAAGCTGAATCGTTGAGTTC TGTAAAGAAGAAGCTTGAAACCGAACTTCTCGCGATTCAAGCTGATCTGGATGAAACTTTGAACGAGTACAAAGCTTCAG AAGAGCGCTACAAAGCAGCAAGTAGCGATGCCGCACGACTTGCTGAACAACTGCGACAAGAACAAGAAAATTCTTTACAG AATGATCGCATAAGAAAGGCTTTGGAATCTCAGTGCCGAATTCGGCACGATGCAGGCACGCCTGGATGAAGCCAGAAAGC CCGCTGCGCCTAAAAGGGTGGCAAGAAAGTTCATTGCCAAACTGGGAATCTCCGCCATTCCGTTGAGCCTTGAAAAGCCG AACTTGAATGGAGAACAGCCGACGAATATCAAGAGACAAATAAAAGTCTTACTAAGCATGAAAGACGCATTCTTTTTCTT CAGTTTCAGGTGGATGAAGATAGANAGAATGCCGAAAGAACGAGAGATCTTATCGAAAAACTGCAGAACTAGCTAAAATC ACAAAAGAAGCAAATTGAAGAAGCCGAAGAGTGAGCAAATGTGAATCTACAAAAGTTTCGCCAAATACAGCATCAGTTGG ACGATGCAGAAGAGCGTGCCGACCATGCCGAAAATTCTCTTTCTAAAATGCGGGCCAAAAGTCGCAGCGGTATGACAGCT TCGCCAGGAGTACAAATCTCCCAGTCATCTATTCTCCGTTCCTCTTCACGCGCACAGTTTTAGTGGCCTAGATGAACTAT TATTTCGTTCAATATGCAGATTTTTTTCTTCGTTCTGATCTGTATTAGTGACATTTTGTCCCACAATAAACATTCATTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_759: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722521537199AA052021SWMFCA730SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7523411668325AA114454MBAFCE5A06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13668312605369AA661325MB3D6V5F07T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 19:28:8 on Sun 19 Nov 117.