CBrugiaQ_763


Sequence

>CBrugiaQ_763 (5 EST) Length=502 ACCCAAGTTTGAGTAATGGTAGCGGCACCGAAAGTTAAGAAGCATACTGTATCAAAAAGGAGCAAGAAATCGGATAGTGG AAAGACGAAGAAAAAGAAGAAGCAAACGCTGAAATATAATATTGAGTGTAAAAATCCTGTAGAAGATGGTATTATGAATG TGAACGACTTTGGGACATTTCTAAATGAGCGTATCAAAGTGAATGGAAAAGTTGGTACAATGGCAGCGAATGGTGTAAGA TTGGAAGTTACTAAAACGAAGCTTATCCTTACGTCAGAGGTTCCATTTTCGAAGAGATATCTGAAATACCTCACGAAAAA GTATTTGAAACGCAATTCGCTTCGCGAATGGTTGAAAGTGGTGGCTTCTTCCGAAAGAAACGTATGAATTGAGATATTTC CAGATTAATCCAGGATGATGAAGATGATAGTGACNATGAATCCTGATCTTTTTTTTTTTGGCNGTTGATTTGGCATTACT TTGATGATGATAAACGGTGGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_763: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5594701345291W51578AS4SLC770T3Brugia malayi L4 JHU93SL-BmL4
8809161870900AA241608MBL2SJ2B5T3Brugia malayi second stage larvae JHU96SL-BmL2
8986931893298AA257523MBL2SJ3E1T3Brugia malayi second stage larvae JHU96SL-BmL2
9101201906185AA269123KJ4SLB115T3JHU93SL-BmL4 (JHU)
10483132064960AA406968MBAFCZ7D07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:12:54 on Sat 18 Nov 117.