CBrugiaQ_764


Sequence

>CBrugiaQ_764 (4 EST) Length=495 CCCAAGTTTGAGTCAAAACAATGNTTGAGGAAAAATGTCACTAACATTTACGGGAAGCGCACAGATTGGAAGGAAGACCG GACAAAGCTACGATTCAAAAAATGCTGGATGAGAATGGTCAGTTGATTAGAGTTATCGTACGGTACCAGAACATGGGAAG GGCAAATGATGCGCTACAGTACCAGCAACTTCTTCATCGAAATCTCGTCTATCTCGCTTCATTAGCTGATGCTAGCATCC AGCAGGAGCTTACCCAGCAGAACGACAATATAAAAAAGGAGGTTACAAGGCAAGATCTAATTTCAAATCAACAAAATACT TAGGACGAATTATTCACAGCTTCATATACCATACTGAGCATTTGTACATGATTTATGCGTTTTACAGTCTTTTTTGAAAA GGACTTTGTTTTATCCGTCGATCTATCTTTTAGTAAGAAAATCGTTTTCCGTACTGTTCCATATTTGCAACAAAATAAAC AAATAATTTCCTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_764: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4449491172331N43448AS4SLC572T3Brugia malayi L4 JHU93SL-BmL4
4621631199678N56586RRAMCA099SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8003441737727AA161613MBAFCG0H07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12652202402591AA588928KJ4SLB359T3JHU93SL-BmL4 (JHU)


Date: 6:30:18 on Thu 23 Nov 117.