CBrugiaQ_767


Sequence

>CBrugiaQ_767 (2 EST) Length=522 TTTGAGAAAAATCTGCAATCAGTTATGCATTCAGTACTGCATGAGCTAACGAATGAAGAATTACGAATGATCGATGATTT ACGAACAGTTATACCAGCACTTCAAACTGTTAATGATGGCTATATTGCGAGGTGGTTACGTTCACGTGACGGACGTTTCG ATGAAACCGCTGATGCATTGAAGAAACATGTGGTATTTCGAAAAGCGTGGGATCTCGATAATTTACCAAATTGGAAAGCA CCCGAAATTCTAGAAAAATACTGTGGTTATGGATTCTTATCAGATAAAGATGGTTTTCCAATACTTATGTCTTTATTGGG TAACATGGATGTTGAAGGAATGTTGAAATCAGTGCAATCCAGTGATTATATCAAATATTCTCTCGCTGCAATTGAACGGG GTATACGACTATGCAGCGATAAATCCAAAGAGAACGGTCATGCATTTGAACAAATGATGATTGCTTTCGACTTGGATCAC ATCAGTAGTGCACATTATTCATGCAAAGCATTCGCTTCTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_767: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10482842064931AA406939MBAFCZ7A11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10750712113548AA430791RRAMCA1456SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 21:31:57 on Fri 24 Nov 117.