CBrugiaQ_771


Sequence

>CBrugiaQ_771 (2 EST) Length=568 GGGATGGGTCGTTGTTGTTGGCTCATTTTTCATTCATGTTTTTGCCGATGGTATTGTTTATTCATTTGGCATTCTCCTCG AAATTATCATGAAGGAATTTGATGTGAGTAATGCTAAGGCATCGATGATAATTTCATTATTAACAGGTTTAACCCTTGGA ATGGGACCTATAGCCAGTGCAATAACAAATAAATTTGGATGTCGGGTGACAACAATTCTGGGATCATTGATCGCAACCAC AGAGTTGTGCTACATCCTATTATGCAACTTCAGTGGAATATCTGATGGTTTCGGTAGGTTGTGTGATGGGCATCGGTTTT GGTTTAATGTACTGTCCGGCTATTGTCATTGTTAGTATGTATTTCGAAAAGAAAAGATCTATGGCTACCGGTATAGCAGT ATGTGGTGCTGGTGTTGGTACAGTCGTATTTGCACCAATCAGTGAAGCACTCATTAAGATTTCCTGGAGAACTGTTTTCG CTGTTTATACGGCAATTGTATTAATGTGTTCTTTATGTGGTGCCACTTTTCGATCGTTAACATTTGTTGCTGTAGAAGAT GAAACAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_771: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9139581911882AA272955SW3ICA2392SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10774622125766AA433168RRAMCA1611SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 11:55:16 on Thu 23 Nov 117.