CBrugiaQ_776


Sequence

>CBrugiaQ_776 (2 EST) Length=523 CTTTTGTTCTCGCTCAAATAAACTGAAACAAAAATGTGCGACGAGGCAAGTAGCAGCATTAGTAGTAGATAATGGATCCG GTATGTGCAAAGCCGGATTTGCTGGTGATGATGCACCTCGAGCTGTATTCCCATCAATAGTTGGACGACCAAGGCATCAA GGTGTCATGGTCGGTATGGGTCAAAAGGATTCATATGTAGGCGATGAGGCTCAGTCGAAAAGAGGTATTCTAACACTAAA ATATCCAATTGAGCATGGCATTGTCACAAACTGGGATGACATGGAGAAGATCTGGCATCATACTTTCTACAACGAACTTC GAGTTGCTCCCGAGGAACATCCAGTACTGCTTACCGAAGCGCCGTTGAACCCAAAGGGCAAACAGAGAAAAGATGACCCA NATTATGTTCGAGACATTCAATACTCCGGCTATGTACGTTGCCATCCAAGCTGTTCTGTCGTTGTACGCATCCGGTCGTA CCACTGGTATTGTGCTTGATTCCGGAAATGGTGTTACTCCCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_776: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10988452168015AA454346MBAFCX0E03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12618382393034AA585622SW3D9CA338SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 1:28:31 on Sun 19 Nov 117.