CBrugiaQ_777


Sequence

>CBrugiaQ_777 (8 EST) Length=519 CCCAAAGGCCCGAAGTTGAAATATTTCCTTTTAAAGTTTTTCACAANTCTGTTATTTATGAATTATCGGAATGATATCTG TTACTTATGAATTATCACATACGGCAATTATAACTCAGTGAAGCTCATGTCCAAAGTGACTTTGAATGTGTTTTGCCATG GTGCTGACCCAAACTTCTATTTTGAATTGCTTTGTCGGTTTACTGCTGTCGATAGTACATTTCATTGGATTCATTCCAAC AGCACCCTTTCTACAGGTGGTCGGTGCAGCAAGAATTGTGAGGTAGTATTTGATTCCGGCCACCACCTGAGTTTGAGCAC TGATAACTCTCACCAATTTGTAGAGATTTCTATATCTAGTCTGGTCATTCACTTGTTCCATCGCTTTTTCTGCTACTTCC TGTATTTCTTCATCATCTTCATTATATGTAGCTCTGCTTAATCGTATTTCCCTAGCAAAGCTTTTAGATATGATTAGTAA CACTGACAACCATACAATCGGGAAGAACAGCTCAGACGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_777: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
273955878861H14041AS3ISB365SLBrugia malayi infective L3 JHU93SL-BmL3
276415881981H16477AS3ISB272SLBrugia malayi infective L3 JHU93SL-BmL3
281244890001H21306AS3ISB203SLBrugia malayi infective L3 JHU93SL-BmL3
3644741017401H63055AS3ISB154T3Brugia malayi infective L3 JHU93SL-BmL3
3918141079833H89403RRAMCA063SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4451941182221N43693SW3ICA723SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4452281182255N43727SW3ICA1183SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141391912509AA273135SW3ICA2559SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 22:19:57 on Sat 18 Nov 117.