CBrugiaQ_779


Sequence

>CBrugiaQ_779 (4 EST) Length=521 TTGAGGTATAAATTTCGGAAACTCTCATAATGATGAAAAGCGCGAGATTTCCATTCTACACATCACTGTTACTGTTTTGT GCTCTTGGTGTGACAATGTTGTTAGCAGAATCACATGAATACTTCCAGAAATCTTATAACTTTAAAATGAGCGATCAAGA CGATGACAGTTCCTCAGAGGAAGAACCCACTAATGATTTTAACCTTGAAAGTTGGGTCCAATCAAACGATTACAGTAATA CAAATCGACAGATGGTGCCACTGAGTCGTATGCGTCCGATTAATTTCACGGCCGCTAATATTTTGTTCAGAAGAGTTAAT TATGCGTCTTAATCAACGGATTTACAGAAGCACAAAACTTTTGTTTCATTATATTCGTGATGTTTGTTGCTGAAAAAGTT TGAAATTTTTTATTATTAACATTTTTGAATGCCAAATTATTTTCCATTTTAATATAATCGATTTCCATTCCTTATTTTGT AATCATTTGACGAACTGGATAAAAAGAATGCCACCCGAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_779: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826581549486AA056807SWMFCA726SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6838431550602AA057949SWMFCA972SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7471751660785AA109328MBAFCE0D08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9140931912017AA273082SWMFCA1902SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 8:56:0 on Tue 21 Nov 117.