CBrugiaQ_78


Sequence

>CBrugiaQ_78 (14 EST) Length=828 AAAATCTTCCCTAAGCAGCATTCCCGGTATGGGATTAACATTTCAGTGGTTAAAGATAAACTAATTATGTAAATTTATTC GGGATTTGGTTAACTAACAATGGTTATCCGGGTTGTTATAAGCTTGTGCTTGGAGAATAATAATTCTTGTAACTCATGTC AACATTGTTTCATCTATATATCAATAGATTAACCCAATTAGGGAGATAGGAATTACTGTTTCTTTTTGGAATTGGGATAA ATTTTAAAATTTTGAGCTTGAACGCTTTCTTTATTGGTGGCTGCTTTAAAGCCAACTATGGTTTATTGGTATTTTGGTTA TTCACTATTAAAGGCTGTATCCTTGGCCTAAAGAGCTGTACCTTTTTAGGCTATCTTTTAAGCTTACATGGGGATTGTAA ATTCTAGGGGTAGGCTTAAAGTTGAACTAAAATTCATTAGTTGGGTAACCAGCTATCACCAAGCTCGTTAGGCTTTTCAC CTCTACCTAAAAATCCTCCCACCATTCTGTCACATGGACGGGTTAACTCATAAAGTTGTTCTTAGGTAGCTCGTTTGGTT TCGGGAATACTAACTGAAGTCCTCTTAGCTAGTATAGTTCTAATTGATCCATAATGCAAAAGGTACAAGGGGGAATCTTT GCTTGTTTTTACTATAAGTTGTAATTCTTTCATCTTTCCCTTGCGGTACTTTCTCTATAGCTTCTGAAATAAGATTTCTT TCTCTAATACTTTAATTAGACTGAATGATTTGATTTATGTAAGAGTTATAGTTGTATTTATATTCGGTAGAGCTAGGTCC NNCTCAAAGTGTTCATAGTTGTGAATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_78: (14 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350175988806H48965SWMFCA012SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4425551164703N41105SWMFCA277SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6186361463737AA007732SWMFCA410SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6363681486133AA022351SWMFCA472SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6364081486173AA022391SWMFCA524SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6364201486185AA022403SWMFCA564SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6722661537213AA052035SWMFCA754SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6837941550553AA057913SWMFCA913SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855501876954AA246146SWMFCA1626SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8944371887862AA253513SWMFCA1398SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11587782252955AA514138SWMFCA2243SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11587892252966AA514149SWMFCA2260SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11919012307143AA545852SWMFCA2390SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12139142334996AA563531SWMFCA2493SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 8:51:33 on Fri 24 Nov 117.