CBrugiaQ_783


Sequence

>CBrugiaQ_783 (4 EST) Length=529 CTTATTTATATCTAGATACATGTAGTTTTGTTAAGTCAAATTTTTTGAGGATTACTTTTGTCTTATTATCTATTATTCAC CTAATCATTATAAATTCTAAAAAGCATCATTATAAATTCTGCTAAATATAGGCATTTATAGTGATGTTCGTTAATACGAA ATATTTACAAAATATTCGTGATATTGGATTTCTGGAAAAAGGAAATGAGATGGAAAATAATACAGGAACATCTGGATAAA GTAAACCTTGCGTTTTGTGTAATGTTCCCATTGGTGAACTGAAGGGACAAATTTCCATTTTCCAGATTATATCAAACAAT GTATTGTTATCATTGTACTGATGCCAACACTGCAATCCTCTGTAGATTAGGTCGTTGGCTATTTCGTGTTCAAAATTTTC ATTTGGTTGATTAATACGATCGGTTTATACAAGCATTCTCATCAATAATTATGTTTTTTTGATGTTACAACATATTGGAT CCCATCCTGAAAAAAAACTTTGATGATGAAATGAATTGTTTACAATTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_783: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7496521663656AA111766SW3ICA1746SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9215071923358AA280497SWMFCA2191SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10751052113582AA430900RRAMCA1497SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11918712307113AA545822SWMFCA2320SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 16:15:33 on Tue 21 Nov 117.