CBrugiaQ_786


Sequence

>CBrugiaQ_786 (3 EST) Length=664 TTGTCAAAACACATAGGTCTCATCGAAAAATGGCAAATGCTGCGGGCTACTTGTACCGTTATCAGCTGACTCAGCTTCCA CGAAGAAAAGTATTGTGGAAAGATTGTTGGCATAAGGAATTAAAACCACCAACGTTGGAAGATTGGCCTACTATAAAGAA AGATTTCAAGCAAATGATGGATGCCATTACAAGCAGATCATATATTCAGTGGACCGTCATGGATACACTAGTGCGAACAT GTATTGCAGTGGAAATAATTTGTTGGTTTTTTGTTGGTGAAGCTATTGGACGTCGTTCGTTTGCTGGATACATTGTTCCA GCAAACTATGTTGACAAAAAGCTGACCAACATGATGAAGCATCACAAAGATAACACTTGTGATATTCCTCCAAAAGCTTG ATGAACATCGTAGTTTTTTTTCCTAATTTATTTTGGAAATATGTATTTGAAGTTTTTACAAACAAAAATAATTAAAAATC CAGTAGCTCTTGTCAATTACTGATAAACGTTACGACATATTTAGCAAGCGAATGTTTAGATTTTTATAGTTATGCTAATA GGCGCGTGCAGGTTCTGTGTTTGGAAGTCGAAAAGCTATATGTTGATATAATATGCTGCGCTAGTATTTTTTTTTCTTGC GTTGATATATTTCGATAGATTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_786: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435307
4451521182179N43599RRAMCA090SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10482202064867AA406667MBAFCZ6C10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:57:54 on Tue 21 Nov 117.